Novel small molecule inhibitors of the transcription factor ETS-1 and their
antitumor activity against hepatocellular carcinoma
Yamin Jie a
, Guijun Liu b
, Mingyan E c
, Ying Li d
, Guo Xu a
, Jingjing Guo e
, Yinyin Li f
Guanghua Rong g
, Yongwu Li h
, Anxin Gu c,*
a Department of Radiation Oncology, The Fourth Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, 150001, China b The Second Affiliated Hospital of Heilongjiang University of Chinese Medicine Harbin, Heilongjiang, 150040, China c Department of Radiation Oncology, Harbin Medical University Cancer Hospital, Harbin, Heilongjiang, 150040, China d Institute of Hard Tissue Development and Regeneration, The Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, 150001, China e Department of Out-patient Clinic, First Medical Center of Chinese PLA General Hospital, Beijing, 100853, China f Department of Liver Disease, The Fifth Medical Center of PLA General Hospital, Beijing, 100039, China g Department of Oncology, The Fifth Medical Center of PLA General Hospital, Beijing, 100039, China h Department of Radiology, The Fifth Medical Center of PLA General Hospital, Beijing, 100039, China
ARTICLE INFO
Keywords:
Hepatocellular carcinoma
E26 transformation specific sequence 1
Small molecular inhibitor
Matrix metalloproteinase
ABSTRACT
The transcription factor ETS-1 (E26 transformation specific sequence 1) is the key regulator for malignant tumor
cell proliferation and invasion by mediating the transcription of the invasion/migration related factors, e.g.
MMPs (matrix metalloproteinases). This work aims to identify the novel small molecule inhibitors of ETS-1 using
a small molecule compound library and to study the inhibitors’ antitumor activity against hepatocellular car￾cinoma (HCC). The luciferase reporter is used to examine the inhibition and activation of ETS-1’s transcription
factor activity in HCC cells, including a highly invasive HCC cell line, MHCC97-H, and five lines of patient￾derived cells. The inhibition of the proliferation of HCC cells is examined using the MTT assay, while the in￾vasion of HCC cells is examined using the transwell assay. The anti-tumor activity of the selected compound on
HCC cells is also examined in a subcutaneous tumor model or intrahepatic tumor model in nude mice. The results
show that for the first time, four compounds, EI1~EI-4, can inhibit the transcription factor activation of ETS-1
and the proliferation or invasion of HCC cells. Among the four compounds, EI-4 has the best activation. The
results from this paper contribute to expanding our understanding of ETS-1 and provide alternative, the safer and
more effective, HCC molecular therapy strategies.
1. Introduction
Currently, more than 80 million people in China suffer from the
hepatitis B/C virus (HBV/HCV) (Siegel et al., 2019). As the disease
progresses and worsens, these patients have a high risk of eventually
developing hepatocellular carcinoma (HCC). HCC is therefore a major
challenge for China’s public health (Siegel et al., 2019; Wang et al.,
2014). What is even more worrying is that, due to the many limitations
of the current clinical diagnosis technology, most HCC patients are
already at advanced stages of the disease—i.e. HCC BCLC stage B or
C—when they are diagnosed and can therefore not undergo radical
treatments such as surgery or liver transplants (Forner et al., 2018). At
present, the only antitumor drugs available for treating advanced HCC
are the various molecular targeted drugs provided by Sorafenib (R. Jr
Roskoski, 2020; R. Jr Roskoski, 2019). Although the global multicenter
randomized controlled clinical trials, which were conducted through
Oriental and SHARRP experiments, show that Sorafenib could prolong
patients’ lives, Sorafenib drugs still face various challenges (Zhu et al.,
2017). First, there are individual differences in patients’ sensitivity to
Sorafenib, with only 20%–40% of patients able to undergo Sorafenib
treatment. Second, with the progress of treatment, patients who were
originally sensitive to Sorafenib are prone to develop resistance to the
drug. To solve these problems, the current main strategy is to develop
new molecular targeted drugs, such as Regorafenib—trade name
* Corresponding author.
E-mail addresses: [email protected] (Y. Jie), [email protected] (G. Liu), [email protected] (M. E), [email protected] (Y. Li), guoxu19861025@
163.com (G. Xu), [email protected] (J. Guo), [email protected] (Y. Li), [email protected] (G. Rong), [email protected] (Y. Li), guanxin@
hrbmu.edu.cn (A. Gu).
Contents lists available at ScienceDirect
European Journal of Pharmacology
journal homepage: www.elsevier.com/locate/ejphar
Received 23 April 2021; Received in revised form 11 May 2021; Accepted 26 May 2021
Stivarga—developed by Bayer, and Levatinib—trade name Lenvi￾ma—developed by Eisai. These two drugs are approved by the Food and
Drug Administration (FDA) for the treatment of advanced HCC (; Bruix
et al., 2017). Although Regorafenib and Levatinib are considered to be
better than Sorafenib, their chemical structures are similar to that of
Sorafenib, and all three share the same chemical structure: [1-(4- (pyr￾idin-4-yloxy) phenyl) urea]. Therefore, it is important to explore alter￾native drugs for treating advanced HCC.
The transcription factor E26 transformation specific sequence 1
(ETS-1) plays an important role in the proliferation and metastasis of
malignant cells (Bhagyaraj et al., 2019). ETS-1 mediates the transcrip￾tion of matrix metalloproteinase (MMPs) in response to HGF/c-MET to
destroy the extracellular matrix (ECM) of the tumor cell at the primary
lesion site, directly causing the malignant cells to break through the
tissue structure of the primary lesion and then metastasize to other sites
(Breunig et al., 2018). Therefore, down-regulating the activity of ETS-1
not only inhibits the aggressive growth of malignant cells but also pro￾vides a promising therapeutic strategy for advanced HCC treatment.
At present, there are no reports available on the small molecule in￾hibitors of ETS-1. Therefore, four small molecule inhibitors of ETS-1
were first identified by screening small molecule compound libraries,
and the antitumor activity of these agents on HCC cells was determined
through multi-assays.
2. Materials and methods
2.1. Cell lines, agents and plasmids
A highly aggressive HCC cell line, MHCC97-H, and a less aggressive
HCC cell line, MHCC97-L, were purchased from the Type Culture
Collection of the Chinese Academy of Sciences (Shanghai, China) and
were described in the previous publications (Y.P. Yang et al., 2013). The
five lines of patient-derived HCC cells were conserved in the lab and
obtained from the clinical specimens following the methods outlined by
(Zhang et al., 2018). The small molecular inhibitors of kinase:
LY294002, an inhibitor of the PI3K/AKT pathway; CP690550, an in￾hibitor of the Jak/STAT pathway; GSK2118436, an inhibitor of the
MAPK pathway; or ARQ-197, an inhibitor of the c-MET, were purchased
from the Selleck Corporation located in the United States in Houston,
Texas. The plasmids—i.e., the vectors with full length sequences of
ETS-1 and the luciferase reporters with the ETS-1 binding sites (EBS)
located in the targeted genes—were described in the previous publica￾tion (Q. Yang et al., 2013). Luciferase revealed the effect of EIs on the
activation of luciferase reporter and the qPCR revealed the mRNA level
of ETS-1’s downstream genes, mmps. The luciferase reporter (EBS-Luc)
used in the manuscript: EBS (ETS binding site) (GGAA)8 sequence was
synthesized by using chemical synthesis methods and cloned into the
pGL3 vectors (Q. Yang et al., 2013).
2.2. Activation/examination of the compounds
A molecular library of 373 molecules was used to identify ETS-1
inhibitors. These compounds were originally designed as PI3K in￾hibitors, but the actual test found that they basically have no inhibitory
activity on PI3K (these compounds inhibit PI3K activity above 600–800
μmol/l). Prof. Cao Shuang from Wuhan Engineering University who also
gave technical guidance (Feng et al., 2020; Feng et al., 2020). The pri￾mary screening of these compounds on ETS-1 was performed by lucif￾erase, all compounds were used in two doses (1 μmol/l and 10 μmol/l) to
detect the inhibitory activity of the compounds on the ETS-1 activity
reporter gene EBS-Luc. The N atom of the piperazine group on
1-(4-(piperazine-1-carbonyl)phenyl)thiourea skeleton was modified and
methyl, ethyl, isopropyl or acetyl groups was introduced to obtain
compounds EI-1, EI-2, EI-3 or EI-4, respectively. The inhibitory activa￾tion of compounds EI-1, EI-2, EI-3 and EI-4 on ETS-1’s transcription
factor activation was examined by using the luciferase assays by using a
series concentration (10 μmol/l, 3 μmol/l, 1 μmol/l, 0.3 μmol/l, 0.1
μmol/l, 0.03 μmol/l and 0.01 μmol/l) (Ji et al., 2017). The pk-values
(hydrophilicity) of EI-1 ~ EI-4 was measured by the neural network
(Yang et al., 2020). The MHCC97-H cells were cultured and transfected
with the luciferase reporters. After transfection, the cells were treated
with the indicated concentration of compounds and harvested to
examine the luciferase activation following the manufacturer’s in￾structions (Promega Corporation, USA) (Ji et al., 2017; Li et al., 2021).
The affinity between the compound and the ETS-1 protein was examined
using the surface plasmon resonance (SPR)—specifically the SPR-based
Biacore T100 provided by the GE Healthcare/Biacore located in
Uppsala, Sweden—and following the methods described previously (Yu
et al., 2004). The specificity of agents was examined by using the
western blot. The HCC cells were treated with LY294002, CP690550,
GSK2118436, ARQ-197, or EI-4 and were harvested for western blot
assays. The level of MEK, MEK phosphorylation, AKT, AKT phosphory￾lation, and MMP3 was examined by analyzing their antibodies, which
were purchased from the Abcam Corporation located in the United
Kingdom. The images of western blot were quantitatively examined by
the ImageJ software (Ma et al., 2020; Wang et al., 2020).
2.2.1. Compound 1 (EI-1)
1-(4-(4-methylpiperazine-1-carbonyl)phenyl)-3-phenethylthiourea
m.p.: 172–173 ◦C. 1
H NMR (400 MHz, DMSO‑d6) δ 9.70 (s, 1H), 7.89
(s, 1H), 7.50–7.17 (m, 10H), 3.70 (t, J = 6.9 Hz, 2H), 2.87 (t, J = 7.4 Hz,
2H), 2.29 (s, 4H). MS (ESI) m/z: 383.15 [M + H]+.
2.2.2. Compound 2 (EI-2)
1-(4-(4-ethylpiperazine-1-carbonyl)phenyl)-3-phenethylthiourea
m.p.: 196–197 ◦C._1
H NMR (400 MHz, DMSO‑d6) δ 9.70 (s, 1H), 7.88
(s, 1H), 7.48–7.37 (m, 2H), 7.35–7.05 (m, 8H), 3.69 (d, J = 7.0 Hz, 2H),
2.86 (t, J = 7.4 Hz, 2H), 2.33 (q, J = 7.2, 6.3 Hz, 6H), 0.98 (t, J = 7.2 Hz,
3H). MS (ESI) m/z: 397.32 [M + H]+.
2.2.3. Compound 3 (EI-3)
1-(4-(4-isopropylpiperazine-1-carbonyl)phenyl)-3-
phenethylthiourea
m.p.: 170–171 ◦C._1
H NMR (400 MHz, DMSO‑d6) δ 9.69 (s, 1H), 7.88
(s, 1H), 7.53–7.03 (m, 9H), 3.69 (s, 2H), 2.76 (dt, J = 82.3, 7.0 Hz, 3H),
2.41 (s, 6H), 0.95 (d, J = 6.4 Hz, 6H). MS (ESI) m/z: 411.37 [M + H]+.
2.2.4. Compound 4 (EI-4)
1-(4-(4-acetylpiperazine-1-carbonyl)phenyl)-3-phenethylthiourea
Y. Jie et al.
m.p.: 195–196 ◦C._1
H NMR (400 MHz, DMSO‑d6) δ 9.72 (s, 1H), 7.90
(s, 1H), 7.51–7.15 (m, 9H), 4.34 (t, J = 5.1 Hz, 1H), 3.70 (d, J = 7.0 Hz,
2H), 2.87 (t, J = 7.4 Hz, 2H), 2.00 (s, 3H), 1.04 (t, J = 7.0 Hz, 1H). MS
(ESI) m/z: 411.22 [M + H]+.
2.3. Cell culture and the cellular survival examination
Hepatic cell lines were obtained from and maintained under the
recommended culture conditions (Yang et al., 2019). Cells were treated
by the indicated concentration of agents, following the descriptions
provided by previous publications (Xie et al., 2018, Y.L. Wang., et al.,
2018). The related cell number was examined by the MTT experiments
and reflected by the O.D. values at 490 nm (Feng et al., 2020). The
inhibitory rates and the IC50 values were calculated according to the
inhibitory rates of compounds on HCC cells (Li et al., 2018; Guan et al.,
2017).
2.4. The antibody and western blot (WB)
The antibodies against MMP3, ETS-1, GAPDH, MMP9, uPA, SRC-1 or
AIB1 used in the WB or the ChIP experiments were purchased from
Abcam (Cambridge, CB2 0AX, UK) or Santa Cruz Corporation (Dallas,
Texas 75220, USA). The hepatic cell lines were cultured and treated with
agents. The protein samples were extracted from the hepatic cells and
analyzed by SDS-PAGE. The protein bands in the SDS-PAGE gels were
trans-printed into the PVDF (polyvinylidene difluoride) membrane
(Millipore, Merck KGaA, Darmstadt, Germany). The membranes were
blocked by 5% BSA (Bovine Serum Albumin) diluted by TBST (Tris
Buffered Saline with Tween 20) for 2h at 37 ◦C. After blocking, the
membranes were incubate with the primary antibodies and the sec￾ondary antibodies sequentially. The bands of the proteins were
measured by chemiluminescence-method and X-ray films. The images of
western blot were quantitatively measured by images J software (Na￾tional Institutes of Health [NIH], Bethesda, Maryland, USA).
2.5. qPCR experiments and Chromatin immunoprecipitation (ChIP)
After treating HCC cells with a series of concentration gradient drugs,
an RNA sample was extracted from the cells following the manufac￾turer’s instructions (ABI) (Du et al., 2020; Shao et al., 2020). The sam￾ples were then reverse transcribed and quantitative PCR experiments
were performed. The expression intensity of the target genes MMP3 and
MMP9 was based on the loading control (β-Actin] and was determined
using the SYBR Green staining 2- △△ CT method to calculate the MMP3
and MMP9 levels in the qPCR experiments. The primer sequences used
in qPCR experiments are: (1) qPCR primers for MMP3—i.e., forward
primer 5′
-CACTC ACAGACCTGACTCGGTT-3′ and reverse primer
5′
-AAG CAGGATCACAGTTGGCTGG-3′
—and (2) MMP9 qPCR pri￾mer—i.e., positive forward primer 5′
-GCCACTACTGTGCCT TTGAGTC
and reverse primer 5′
-CCCTCAGAGAATC GCCAGTACT-3’. The ChIP
assays were performed following the methods described in the previous
publication (Shao et al., 2020; Zhu et al., 2014). The recruitment of
ETS-1 to its downstream gene mmp9’s promoter region was revealed by
examining the complex between ETS-1/DNA. The MHCC97-H cells,
which were pretreated by EIs from 6 h, were treated with 10 ng/ml HGF
or solvent control for 30 min; the DNA fragment binding with EST-1,
which contained the promoter region of mmp9’s promoter, was exam￾ined by qPCR; and the primers, which were used in ChIP, were listed as
“MMP9 promoter forward 5′
- TACATTGGTACCTCTTGGGTCTTGGCCT￾TAGT -3′
” and “MMP9 promoter reverse: 5′
- TTGA￾TACTCGAGCCAGCACCAGGAGCACC -3′
.” (Zhu et al., 2014). The
negative region of the genomic DNA was amplified by the: (1) forward
premier: 5′
-AACCTATTAACTCACCCTTGT-3’; (2) reverse premier:
5′
-CCTCCATTCAAAAGATCTTATTATTTAGCATCTCCT-3’ (Zhu et al.,
2014).
2.6. In vitro invasion experiments
A transwell assay was used to detect the invasion of in vitro HCC cells
(Zhang et al., 2013). After treating the HCC cells with agents for 24–36
h, transwell experiments—following the method described in (Wang
et al., 2019)—were performed to measure the in vitro invasion. The
Image J software quantitatively analyzed the images and identified the
invasive cells (H. Yang et al., 2020). The inhibitory rates of the agents
were calculated using the following formula: [(the invasive cells of the
control group – the invasive cells of the agents’ administration
group)/(the invasive cells of the control group)] × 100%.
2.7. The colony formation experiments
L-02 cells were obtained by culturing. After treating the cells with
100 nmol/l paclitaxel or 1 μmol/l EI1~4 for about 48 h, the cells were
collected and seeded in a 6-well cell culture plate. After that, the culture
will continue for about 3–4 weeks, and the cells will form colonies. The
colonies were fixed with absolute ethanol, stained with 0.25% (w/v),
and photographed. Image J software (National Institutes of Health
[NIH], Bethesda, Maryland, USA) was used to quantitatively analyze the
colonies. The relative total colony-area is (the total number of pixels in
the colony)/(the total number of pixels in each hole of the 6-well plate);
the inhibition rate of the drug action is (the control group relative to the
total colony area – the drug treatment group relative to the total colony
area)/(the control group is relative The total area of the colony) × 100%
2.8. The subcutaneous tumor model
The in vivo proliferation of HCC cells were measured by a subcu￾taneous tumor model in nude mice with 4–6 weeks’ age (H. Yang et al.,
2020; Wang et al., 2020 and Ding et al., 2020). The MHCC97-H cells
were harvested and injected into the subcutaneous position of nude
mice. Then, mice were treated with the indicated concentration of EI-4
for 15 times (once every two days) via oral administration. The formu￾lation of agents for oral administration was prepared following the
methods outlined by (Xie et al., 2018). After EI-4 treatment, mice were
harvested and the tumor tissues were collected. The tumor volumes were
measured by the tumor width × tumor width × tumor length/2. The
tumor weights were measured by using a precision-balance. The
expression level of ETS-1 and invasion/migration related downstream
genes of ETS-1 in tumor tissues was measured by using qPCR.
2.9. In vivo invasion experiments
HCC cells were obtained by culture, and the suspension of HCC cells
(MHCC97-H cells or MHCC97-L cells) was mixed with medical gel to
prepare gel droplets following the method laid out by Sun et al. (2019)
and Wei et al. (2019). Next, the hydrogel droplets containing HCC cells
were adhered to the surface of the liver of the nude mice via the open
surgery on the nude mice, allowing the HCC cells to invade into their
liver. The formulation of agents for oral administration was prepared
following the methods outlined by Xie et al. (2018). The PEG400, Tween
80 and DSMO (Dimethyl sulfoxide) were used to dissolve the pure
powders of EI-4, and then the sterile saline were used to dilute the drug
solution to obtain the final formulation (1 mg/ml concentration) for oral
administration. The mice were received the 1 mg/kg dose of EI-4 by oral
administration every two days. The intra-hepatic invasion of the HCC
cells was into nude mice’s liver organs were examined by using the
micro-PET. After about ten times that the EI-4 was orally administered,
the cervical dislocation method were used to kill animals and the livers
of the nude mice were collected for routine pathological staining—H & E
staining—following Wei et al.‘s method (2019). The depth of the inva￾sion of HCC cells was into nude mice’s liver organs were examined by
quantitative analysis of the pathological images of nude mice’s liver
with nodules or lesions formed by HCC cells. This using quantitative
Y. Jie et al.
analysis of imaged were performed by Image J software (National In￾stitutes of Health [NIH], Bethesda, Maryland, USA). The invasion of
HCC cells in the mice’s liver was calculated using the following formula:
(the depth of the invasive growth of HCC cells in the mice’s liver)/(the
hepatic organs’ total thickness) * 100%. While the inhibitory rate of the
compound on the invasion and growth of HCC cells in the mice’s liver
was calculated using the following formula: (the degree of invasion of
HCC cells in the nude mice’s liver from the control group – the degree of
invasion of HCC cells in the nude mice’s liver from the drug treatment
group)/(the invasion level of HCC cells present in the nude mice’s liver
from the control group) × 100%.
2.10. The ethical statement
The usage of the human materials: the HCC cell lines was approved
by the ethics committee of the Fourth Affiliated Hospital of Harbin
Medical University. The animal experiments were performed in accor￾dance with the Guidelines for Care and Use of Laboratory Animals: the
UK Animals (Scientific Procedures) Act, 1986 and associated guidelines
and the usage of animals were approved by the animal-ethics committee
of the Fourth Affiliated Hospital of Harbin Medical University (the
application approval number: DWBA-2019-004A).
Table 1
The IC50 values of small molecular inhibitors on ETS-1’s transcription factor
activation.
Cell lines EI-1 EI-2 EI-3 EI-4
The IC50 values of compounds (μmol/L)
MHCC97-H 0.83 ± 0.10 0.64 ± 0.19 0.78 ± 0.30 0.50 ± 0.13
PDC No. 1 1.77 ± 0.33 1.53 ± 0.26 1.68 ± 0.29 0.95 ± 0.70
PDC No. 2 0.93 ± 0.20 0.62 ± 0.33 0.53 ± 0.07 0.44 ± 0.13
PDC No. 3 1.29 ± 0.24 1.40 ± 0.57 1.09 ± 0.36 1.11 ± 0.76
PDC No. 4 0.45 ± 0.01 0.31 ± 0.08 0.57 ± 0.60 0.22 ± 0.18
PDC No. 5 0.73 ± 0.24 0.98 ± 0.30 0.86 ± 0.34 0.48 ± 0.11
EI: ETS-1 inhibitor; IC50: Concentration with 50% inhibitory rates; PDCs: pa￾tients derived cells.
Fig. 1. The structure of ETS-1’s small molecular inhibitors. (A–D) The binding affinity of EIs (A [EI-1], B [EI-2], C [EI-3], D [EI-4]) at concentrations of 10, 5, 2.5,
1.26 or 0.62 μmol/l (E–I): the chemical structure of EI-1 (E), EI-2 (F), EI-3 (G) or EI-4 (H) is shown and (I) the structure feature of EI1~4 was shown.
Y. Jie et al.
2.11. Statistical analysis
In the presence work, the biological and technical replicates of
western blot or pPCR were carried out for all experiments and the results
were from triple repeats with similar results. The statistical significance
between the groups was analyzed by the SPSS software via a two-tail T￾test, and the IC50 values of agents were calculated by using the Origin
software.
3. Results
3.1. The inhibitory activation of the inhibitors
After the first round of screening, a compound: 1-(4-(piperazine-1-
carbonyl)phenyl)thiourea existed the inhibitory activation on ETS-1.
The N atom of the piperazine group on 1-(4-(piperazine-1-carbonyl)
phenyl)thiourea skeleton was modified and methyl, ethyl, isopropyl and
Fig. 2. The endogenous expression of ETS-1 in HCC cells. (A and B) the protein level (A) and the mRNA level (B) of ETS-1 in hepatic cell lines—a highly aggressive
HCC cell line MHCC97-H, a lowly aggressive cell line MHCC97-L, and five lines of patient-derived HCC cells (PDCs No.1–5)—were examined through western blot
and qPCR. The mRNA level of mmp3 or mmp9 of these cells was also examined by qPCR. *P < 0.05.
Fig. 3. EIs inhibited the transcription factor activation of ETS-1 in HCC cells. MHCC97-H cells were treated with the 300 nmol/l dose of EIs for 48 h and cells were
harvested for the western blot. The expression level of ETS-1 and its downstream invasion/migration related downstream genes was examined by their antibodies.
The results were shown as images of western blot (A) or the quantitative analysis results of these images (B–E). *P < 0.05.
Y. Jie et al.
acetyl groups were introduced to obtain compounds: EI-1, the ETS-1
inhibitor 1; EI-2, the ETS-1 inhibitor 2; EI-3, the ETS-1 inhibitor 3;
and EI-4, the ETS-1 inhibitor 4. These four compounds have inhibitory
activity on the ETS-1’s transcription factor (Table 1). This means that
they can inhibit the activity of the ETS-1 luciferase reporters’ gene SBE￾Luc (Table 1). The interactions between EIs and ETS-1 was confirmed
through SRP methods (Fig. 1A–D). The chemical structure of these four
compounds (Fig. 1E–H) and the chemical features of the four agents
(Fig. 1I) are shown in Fig. 1. Moreover, among the EIs, EI-4 has the
lowest IC50 value on EBS-Luc activation (Table 1). Similar results were
obtained when examining the mRNA level of mmp3 and mmp9, two
typical downstream genes of EST-1 (Supplemental Table 1 and Supple￾mental Table
Moreover, the effect of EIs on the ETS-1’s activation was further
examined by using the western blot and ChIP. As shown in Fig. 2, the
endogenous expression of ETS-1 or MMPs in hepatic cell lines were
measured by the western blot (Fig. 2A) or qPCR (Fig. 2B–D). Among the
cell lines, MHCC97-H has the highest levels of endogenous ETS-1
(Fig. 2A and B) or MMPs (Fig. 2C and D). Treatment of EIs not only
decreased the protein level of MMP3, MMP9 and uPA in MHCC97-H
cells (Fig. 3A–E), but it also inhibited the recruitment of ETS-1 to
mmp9’s promoter region (Fig. 4A–D). Moreover, treatment of EIs also
repressed the recruitment of SRC-1 and AIB-1 to mmp9’s promoter re￾gion (Fig. 4A–D). Moreover, the recruitment of ETS-1 or the effect of EIs
on ETS-1 was further confirmed by using a control region (a negative
genomic region) (Supplemental Fig. 1). The results indicated that the
four compounds obtained, EI1–EI4, have an inhibitory effect on the
transcription factor activation of ETS-1.
3.2. The specificity of EIs’ function
The specificity of EI’s function was examined through western blot
experiments. To confirm the specificity of EI’s function, the phosphor￾ylation of the MEK and AKT were examined and the small molecular
inhibitor of the PI3K/AKT pathway (LY294002), MAPK pathway
(GSK2118436), and Jak/STAT pathway (CP690550) were used. As
shown in Fig. 5A–F, treatment of a concentration of 300 nmol/l of EI-4
significantly decreased the expression of MMP3 but not the phosphor￾ylation of MEK or AKT. Furthermore, treatment of 100 nmol/l LY294002
decreased the phosphorylation of AKT and the expression of MMP3, but
not the phosphorylation of MEK or the expression level of MEK, AKT, or
P70S6K1. Treatment of 100 nmol/l GSK2118436 decreased the phos￾phorylation of MEK and the expression of MMP3, but not the phos￾phorylation of AKT or the expression level of MEK or AKT. Treatment of
100 nmol/l CP690550 did not affect the phosphorylation or expression
of MEK, AKT, or MMP3. Moreover, 100 nmol/l ARQ-197 had a similar
effect as EI-4 on MMP3’s expression. However, ARQ-197 also signifi￾cantly decreased the phosphorylation of AKT and slightly decreased the
phosphorylation of MEK. Therefore, compound EI-4 is a specific inhib￾itor of ETS-1 and does not affect the up-stream related pathway of EST-1.
3.3. The inhibitory effect of test compounds on in vitro HCC cell
proliferation, invasion and migration
The antitumor effect of EIs was examined. As shown in Supplemental
Fig. 2A and in Supplemental Table 3 and Supplemental Table 4, the EIs
inhibited the proliferation and the in vitro invasion of HCC
cells—including the highly aggressive HCC cell line MHCC97-H and the
PDCs—in a dose-dependent manner. Among the agents, EI-4 has the best
antitumor activation, with the lowest IC50 values on HCC cells’
Fig. 4. EIs inhibited the recruitment of ETS-1 or its co-factors to its downstream gene mmp9’s promoter region. MHCC97-H cells were treated with the EIs. Then, cells
were harvested for ChIP assays. The accumulation of EST-1 or its co-factors to its downstream gene mmp9’s promoter region by using its antibody and PCR. The
results were shown as the DNA electrophoresis images (A) or the quantitative results (B–D). *P < 0.05.
Y. Jie et al.
Fig. 5. The Specificity of EI’s function. The MHCC97-H cells were treated with agents and harvested for the western blot experiments. The level of MEK phos￾phorylation, MEK protein, AKT phosphorylation, AKT, and MMP3 was examined by analyzing their antibodies. GAPDH was chosen as the loading control. The results
were shown as images of western blot and (A) quantitative results of the images (B–F). *P < 0.05.
Fig. 6. EIs inhibited the subcutaneous growth of MHCC97-H cells in nude mice. MHCC97-H cells were injected into the subcutaneous position of nude mice to form
tumor tissues. Mice were received the indicated concentrations of EI4 via oral administration. After treatment, mice were harvested and the tumors were harvested.
The expression level of ETS-1 and related factors in the tumors was examined by qPCR. The results were shown as the images of subcutaneous tumors (A), tumor
volumes (C), tumor weights (D) or the heat-map (B). *P < 0.05.
Y. Jie et al.
proliferation and invasion. Similar results were obtained by the migra￾tion transwell experiments. As shown in Supplemental Fig. 2B, EIs also
inhibited the migration of MHCC97-H cells. As expect, the inhibitory
rates of EIs on MHCC97-H cells’ migration is lower than on invasion.
These results indicate that the four compounds examined inhibit the
invasion or migration of in vitro HCC cells.
3.4. The inhibitory effect of test compounds on invasion of in vivo HCC
cells
The above results were obtained through cultured cells. The in vivo
antitumor activation of EIs, on the other hand, was examined adopting a
nude mice subcutaneous growth or intrahepatic invasion model. As
shown in Fig. 6, MHCC97-H cells could form the tumor tissues in the
subcutaneous position of nude mice. Treatment of EI-4 inhibited the
subcutaneous growth of MHCC97-H cells in a dose dependent manner
(Fig. 6). EI-4 also inhibited the ETS-1 downstream invasion/migration
related genes’ expression in these tumors (Fig. 6B).
Moreover, the in vivo invasion of HCC cells was examined by an
intrahepatic tumor model (Fig. 7 and Fig. 8). As shown in Fig. 7, the
MHCC97-H cells in the hydrogel-drops, which adhered onto the surface
of the nude mice’s livers, could invade into the liver tissue. The for￾mation of HCC nodules, or lesions, was examined by using the micro￾PET and H & E staining (Fig. 7A–D). The inhibitory level of EIs was
reflected by the depth of HCC cells’ invasive growth into the mice’s
livers (Fig. 7A–D). The results showed that oral administration of
EI1~EI4 on nude mice can inhibit the intrahepatic invasion of MHCC97-
H cells (Fig. 7A–D). Among the four agents, EI4 has the best antitumor
activation and the highest inhibitory rate (Fig. 7A–D). To further
examine the effect of EIs, MHCC97-L, a lowly aggressive HCC cell line,
was used. As shown in Fig. 8A–D, overexpression of ETS-1 promote the
intrahepatic invasion of MHCC97-L cells. The inhibitory effect of EI-4 on
Fig. 7. EIs inhibited the in vivo invasion, or the intrahepatic invasion, of MHCC97-H cells in an experiment on nude mice. MHCC97-H cells were cultured and mixed
with medical hydrogel to form hydrogel-drips. The drips containing the MHCC97-H cells were adhered to the surface of the nude mice’s livers. The cells then invaded
the mice’s livers, forming nodules/lesions. Mice were received the EIs via oral administration. The intrahepatic invasion of MHCC97-H cells was measured by the
microPET imaging (A and B) and by conducting a pathological analysis (C and D). *P < 0.05.
Y. Jie et al.
Intrahepatic invasion of MHCC97-L, HCC cells with low background
expression of ETS-1, is very weak, but when ETS-1 is overexpressed in
MHCC97-L cells, EI-4 has an effect on MHCC97-L cells The Intrahepatic
invasion has a strong inhibitory effect. These results further confirm the
effects of inhibitors on ETS-1.
3.5. The inhibitory effect of test compounds on L-02 cells
The above results were obtained from the HCC cells. To further
confirm the specificity of compounds’ effect, the inhibitory effect of test
compounds on L-02 cells was examined by colony formation. As shown
in Supplemental Fig. 3, EI1~EI-4 did almost not affect the colony for￾mation of L-02 cells with low endogenous ETS-1 level. As a positive
control, the cytotoxic chemotherapy paclitaxel significantly inhibited
the colony formation of L-02 cells. These results confirmed the anti￾tumor effect of EIs on HCC cells.
4. Discussion
Currently, there are three main types of HCC molecular targeted
drugs: Sorafenib, Regorafenib, and Lenvatinib (R. Jr Roskoski et al.,
2019; R. Jr Roskoski et al., 2020). All three of these drugs directly inhibit
Fig. 8. EIs inhibited the in vivo invasion, or the intrahepatic invasion, of MHCC97-L cells in the presence of ETS-1 overexpression. MHCC97-L cells were cultured and
transfected with ETS-1. Then, cells were harvested and mixed with medical hydrogel to form hydrogel-drips. The drips containing the MHCC97-L cells were adhered
to the surface of the nude mice’s livers. Mice were received with the EI-4 via oral administration. The cells then invaded the mice’s livers, forming nodules/lesions.
The intrahepatic invasion of MHCC97-L cells was measured by the microPET imaging (A and B) and by conducting a pathological analysis (C and D). *P < 0.05.
Y. Jie et al.
the proliferation of HCC cells by acting on the MAPK signaling pathway
and on the receptor tyrosine proteins, such as VEGER, to inhibit the
metastasis and tumor angiogenesis of HCC cells (Bruix et al., 2017; Kudo
et al., 2017). However, there is a compensatory effect between signal
pathways in HCC cells. For example, it has been shown that RTKs, such
as c-MET, can have a compensatory effect on VEGFR, and that the
PI3K/AKT pathway can have a compensatory effect on the MAPK signal
pathway (Booth et al., 2020; Fu et al., 2020). Consequently, although
molecular targeted drugs such as Sorafenib can inhibit the activity of the
VEGFR-related pathway, during the treatment, other signal pathways in
the cell will activate and eventually participate in creating resistance to
Sorafenib. Therefore, research on the development of new and more
effective therapeutic strategies is of great importance.
ETS-1 is a key regulator for the metastasis and invasion of HCC cells.
It directly regulates the metastasis of HCC cells by mediating the
expression of matrix metalloproteinases (MMPs) (Tetsu et al., 2015). In
this study, a small-molecule compound library was used to screen. The
library identified four compounds (EI1~4) with inhibitory activity on
ETS-1. These compounds inhibit the transcription factor activity of
ETS-1 and the expression of ETS-1 downstream genes: mmp3 and mmp9.
At the same time, EI1~4 also have good antitumor activity and can
inhibit the proliferation and invasion of HCC cells through a variety of in
vitro and in vivo models.
Moreover, the HGF/c-MET/ETS-1 pathway provides a promising
therapeutic strategy for HCC treatment. ARQ-197/Tivantinib is a small
molecular inhibitor of c-MET, and a considerable amount of evidence
indicates that the ARQ-197 treatment inhibits the proliferation and the
metastasis of HCC cells (Gao et al., 2019; Rimassa et al., 2018). Given
previous publications and the results of this paper, ARQ-197 inhibits the
expression of MMP3 and MMP9 via the c-MET/ETS-1 pathway.
Although EIs and ARQ-197 have similar effects on MMP’s expression,
the small molecular inhibitor, which directly targets ETS-1, has several
advantages over ARQ-197; ARQ-197 down-regulates the activity of
EST-1 by inhibiting c-MET/AKT, but ETS-1 is still regulated by other
pathways. PI3K, MAPK, etc. can up-regulate the activity of ETS-1.
Therefore, in this study, the ETS-1 inhibitor was obtained by screening
the compound library, and the specificity and potential of its function
are all in the development of c-MET inhibitors. ETS-1 inhibitors were
discovered for the first time in this study. So, not only does this study
help expand our understanding of ETS-1, it also provides more options
for HCC molecular targeted therapy in the future.
The anti-tumor activity of compounds has been confirmed in multi￾assays. The untreated group can be used as a negative control.
Compared with the untreated group, EIs can inhibit the tumorigenesis of
HCC cells in nude mice in a dose-dependent manner. Moreover, the data
mentioning the effects of EIs on non-tumor hepatic cells, L-02, to eval￾uate the possible toxics effects on the normal liver have been added as
Supplemental Fig. 3. The inhibitory effect of EIs on the non-tumor he￾patic cells, L-02, was measured by the colony formation experiments. EIs
could not significantly inhibited the survival of L-02. Although the
“inactive form of EIs” could be benefit for the related research, there is
no “inactive form of EIs” in this study.
5. Conclusion
In this paper, compounds with inhibitory effects on ETS-1 were ob￾tained by screening small molecule compound libraries. The four com￾pounds obtained inhibit the activity of transcription factors of ETS-1 and
the survival, metastasis, and invasion of HCC cells. This paper contrib￾utes to the literature on HCC-related pharmacology and to the devel￾opment of more effective and independent HCC molecular targeted
drugs.
CRediT authorship contribution statement
Yamin Jie: Conceptualization, Methodology, Software, Data
curation, Writing – original draft, Writing – review & editing. Guijun
Liu: Data curation, Writing – original draft. Mingyan E: Data curation,
Writing – original draft. Ying Li: Data curation, Writing – original draft.
Guo Xu: Data curation, Writing – original draft. Jingjing Guo: Visual￾ization, Investigation, Writing – review & editing. Yinyin Li: Visuali￾zation, Investigation. Guanghua Rong: Visualization, Investigation.
Yongwu Li: Supervision. Anxin Gu: Conceptualization, Methodology,
Software, Data curation, Writing – original draft, Writing – review &
editing.
Declaration of competing interest
Authors declare no competing interest.
Acknowledgment and Grant support
We thanks to Prof. Shuang Cao at School of Chemical Engineering
and Pharmacy, Wuhan Institute of Technology, Wuhan City 430072,
Hubei Province, People’s Republic of China for his advice and help. This
work is supported by the founds from Chinese Government (Wu Jieping
Medical Research Foundation No. 320.6750.17212, China; Spark
Research Fund From The Fourth Affiliated Hospital Of Harbin Medical
University No. HYDSYXH201908, Harbin, China; Haiyan Medical
Research Foundation No. JJZD2017-07; National Science and Technol￾ogy Major Project No. 2017ZX10203206), China; Haiyan Science
Foundation of Harbin Medical University Cancer Hospital (JJZD2017-
07), Harbin, China.
Appendix A. Supplementary data
Supplementary data to this article can be found online at
References
Bhagyaraj, E., Ahuja, N., Kumar, S., Tiwari, D., Gupta, S., Nanduri, R., Gupta, P., 2019.
TGF-β induced chemoresistance in liver cancer is modulated by xenobiotic nuclear
receptor PXR. Cell Cycle 18, 3589–3602. http://doi: 10.1080/15384101.2019.1
693120.
Booth, L., Poklepovic, A., Dent, P., 2020. Neratinib decreases pro-survival responses of
[sorafenib + vorinostat] in pancreatic cancer. Biochem. Pharmacol. 178, 114067.
http://doi: 10.1016/j.bcp.2020.114067.
Breunig, C., Erdem, N., Bott, A., Greiwe, J.F., Reinz, E., Bernhardt, S., Giacomelli, C.,
Wachter, A., Kanthelhardt, E.J., Beißbarth, T., Vetter, M., Wiemann, S., 2018. TGFβ1
regulates HGF-induced cell migration and hepatocyte growth factor receptor MET
expression via C-ets-1 and miR-128-3p in basal-like breast cancer. Mol. Oncol. 12,
1447–1463. http://doi: 10.1002/1878-0261.12355.
Bruix, J., Qin, S., Merle, P., Granito, A., Huang, Y.H., Bodoky, G., Pracht, M.,
Yokosuka, O., Rosmorduc, O., Breder, V., Gerolami, R., Masi, G., Ross, P.J., Song, T.,
Bronowicki, J.P., Ollivier-Hourmand, I., Kudo, M., Cheng, A.L., Llovet, J.M., Finn, R.
S., LeBerre, M.A., Baumhauer, A., Meinhardt, G., Han, G., 2017 Jan 7. RESORCE
Investigators. Regorafenib for patients with hepatocellular carcinoma who
progressed on sorafenib treatment (RESORCE): a randomised, double-blind, placebo￾controlled, phase 3 trial. Lancet 389 (10064), 56–66. https://doi.org/10.1016/
S0140-6736(16)32453-9.
Ding, H., Zhang, Y., Zhao, L., Wu, S., Liu, J., Wang, C., Pei, T., Su, Y., 2020 Jul. What
intervention regimen is most effective prevention for Portal venous system
thrombosis after splenectomy in cirrhotics patients with Portal hypertension?
Systematic review and network meta-analysis. Pharmacol. Res. 157, 104825.

https://doi.org/10.1016/j.phrs.2020.104825.

Du, G., Wang, J., Zhang, T., Ding, Q., Jia, X., Zhao, X., Dong, J., Yang, X., Lu, S.,
Zhang, C., Liu, Z., Zeng, Z., Safadi, R., Qi, R., Zhao, X., Hong, Z., Lu, Y., 2020 Feb 12.
Targeting Src family kinase member Fyn by Saracatinib attenuated liver fibrosis in
vitro and in vivo. Cell Death Dis. 11 (2), 118. https://doi.org/10.1038/s41419-020-
2229-2.
Feng, Y.Q., Gu, S.X., Chen, Y.S., Gao, X.D., Ren, Y.X., Chen, J.C., Lu, Y.Y., Zhang, H.,
Cao, S., 2020. Virtual screening and optimization of novel mTOR inhibitors for
radiosensitization of hepatocellular carcinoma. Drug Des. Dev. Ther. 14, 1779–1798.
http://doi: 10.2147/DDDT.S249156. eCollection 2020.
Feng, Y.Q., Li, B.A., Feng, F., Chen, Y.S., Ren, Y.X., Zhang, H., Cao, S., 2020. Novel mTOR
inhibitor enhances the sensitivity of hepatocellular carcinoma cells to molecular EI1
targeting agents. OncoTargets Ther. 13, 7165–7176. https://doi.org/10.2147/OTT.
S244474. Jul 27.
Feng, Y.Q., Gu, S.X., Chen, Y.S., Gao, X.D., Ren, Y.X., Chen, J.C., Lu, Y.Y., Zhang, H.,
Cao, S., 2020. Virtual screening and optimization of novel mTOR inhibitors for
Y. Jie et al.
radiosensitization of hepatocellular carcinoma. Drug Des. Dev. Ther. 14, 1779–1798.
https://doi.org/10.2147/DDDT.S249156. May 8.
Forner, A., Reig, M., Bruix, J., 2018. Hepatocellular carcinoma. Lancet 391, 1301–1314.
http://doi: 10.1016/S0140-6736(18)30010-2.
Fu, R., Jiang, S., Li, J., Chen, H., Zhang, X., 2020. Activation of the HGF/c-MET axis
promotes lenvatinib resistance in hepatocellular carcinoma cells with high c-MET
expression. Med. Oncol. 37, 24. http://doi: 10.1007/s12032-020-01350-4.
Gao, X., Chen, H., Huang, X., Li, H., Liu, Z., Bo, X., 2019. ARQ-197 enhances the
antitumor effect of sorafenib in hepatocellular carcinoma cells via decelerating its
intracellular clearance. OncoTargets Ther. 12, 1629–1640. http://doi: 10.2147/OTT
.S196713.
Guan, F., Ding, R., Zhang, Q., Chen, W., Li, F., Long, L., Li, W., Li, L., Yang, D., Xie, J.,
Yuan, S., Wang, L., 2017. WX-132-18B, a novel microtubule inhibitor, exhibits
promising anti-tumor effects. Oncotarget 8, 71782–71796. http://doi: 10.186
32/oncotarget.17710.
Ji, Q., Xu, X., Li, L., Goodman, S.B., Bi, W., Xu, M., Xu, Y., Fan, Z., Maloney, W.J., Ye,
Wang, Y., 2017 Oct 12. miR-216a inhibits osteosarcoma cell proliferation, invasion
and metastasis by targeting CDK14. Cell Death Dis. 8 (10), e3103 https://doi.org/
10.1038/cddis.2017.499.
Jr Roskoski, R., 2019. Properties of FDA-approved small molecule protein kinase
inhibitors. Pharmacol. Res. 144, 19–50. http://doi: 10.1016/j.phrs.2019.03.006.
Jr Roskoski, R., 2020. Properties of FDA-approved small molecule protein kinase
inhibitors: a 2020 update. Pharmacol. Res. 152, 104609. http://doi: 10.1016/j.ph
rs.2019.104609.
Kudo, M., Finn, R.S., Qin, S., Han, K.H., Ikeda, K., Piscaglia, F., Baron, A., Park, J.W.,
Han, G., Jassem, J., Blanc, J.F., Vogel, A., Komov, D., Evans, T.R.J., Lopez, C.,
Dutcus, C., Guo, M., Saito, K., Kraljevic, S., Tamai, T., Ren, M., Cheng, A.L., 2018.
Lenvatinib versus sorafenib in first-line treatment of patients with unresectable
hepatocellular carcinoma: a randomised phase 3 non-inferiority trial. Lancet 391,
1163–1173. https://doi.org/10.1016/S0140-6736(18)30207-1.
Li, F., Wei, A., Bu, L., Long, L., Chen, W., Wang, C., Zhao, C., Wang, L., 2018. Procaspase-
3-activating compound 1 stabilizes hypoxia-inducible factor 1α and induces DNA
damage by sequestering ferrous iron. Cell Death Dis. 9, 1025. http://doi: 10.103
8/s41419-018-1038-3.
Li, B., Feng, F., Jia, H., Jiang, Q., Cao, S., Wei, L., Zhang, Y., Lu, J., 2021 Mar 21.
Rhamnetin decelerates the elimination and enhances the antitumor effect of the
molecular-targeting agent sorafenib in hepatocellular carcinoma cells via the miR-
148a/PXR axis. Food Funct. 12 (6), 2404–2417. https://doi.org/10.1039/
d0fo02270e.
Ma, Y., Chai, N., Jiang, Q., Chang, Z., Chai, Y., Li, X., Sun, H., Hou, J., Linghu, E., 2020
Oct. DNA methyltransferase mediates the hypermethylation of the microRNA 34a
promoter and enhances the resistance of patient-derived pancreatic cancer cells to
molecular targeting agents. Pharmacol. Res. 160, 105071. https://doi.org/10.1016/
j.phrs.2020.105071.
Rimassa, L., Assenat, E., Peck-Radosavljevic, M., Pracht, M., Zagonel, V., Mathurin, P.,
Rota Caremoli, E., Porta, C., Daniele, B., Bolondi, L., Mazzaferro, V., Harris, W.,
Damjanov, N., Pastorelli, D., Reig, M., Knox, J., Negri, F., Trojan, J., Lopez ´ Lopez, ´
Personeni, N., Decaens, T., Dupuy, M., Sieghart, W., Abbadessa, G., Schwartz, B.,
Lamar, M., Goldberg, T., Shuster, D., Santoro, A., 2018. J. Bruix. Tivantinib for
second-line treatment of MET-high, advanced hepatocellular carcinoma (METIV￾HCC): a final analysis of a phase 3, randomised, placebo-controlled study. Lancet
Oncol. 19, 682–693. https://doi.org/10.1016/S1470-2045(18)30146-3.
Shao, Q.P., Wei, C., Yang, J., Zhang, W.Z., 2020 Jul 27. miR-3609 decelerates the
clearance of sorafenib in hepatocellular carcinoma cells by targeting EPAS-1 and
reducing the activation of the pregnane X receptor pathway. OncoTargets Ther. 13,
7213–7227. https://doi.org/10.2147/OTT.S246471.
Siegel, R.L., Miller, K.D., Jemal, A., 2019. Cancer statistics, CA. Canc. J. Clin. 69, 7–34.
https://doi: 10.3322/caac.21551.
Sun, H., Feng, F., Xie, H., Li, X., Jiang, Q., Chai, Y., Wang, Z., Yang, R., Li, R., Hou, J.,
2019. Quantitative examination of the inhibitory activation of molecular targeting
agents in hepatocellular carcinoma patient-derived cell invasion via a novel in vivo
tumor model. Animal Model Exp. Med. 2, 259–268. https://doi.org/10.1002/
ame2.12085.
Tetsu, O., Phuchareon, J., Eisele, D.W., Hangauer, M.J., McCormick, F., 2015. AKT
inactivation causes persistent drug tolerance to EGFR inhibitors. Pharmacol. Res.
102, 132–137. http://doi: 10.1016/j.phrs.2015.09.022.
Wang, Y.L., Tang, Z.G., 2018. A novel long-sustaining system of apatinib for long-term
inhibition of the proliferation of hepatocellular carcinoma cells. OncoTargets Ther.
11, 8529–8541. http://doi: 10.2147/OTT.S188209.
Wang, F.S., Fan, J.G., Zhang, Z., Gao, B., Wang, H.Y., 2014. The global burden of liver
disease: the major impact of China. Hepatology 60, 2099–2108. https://doi:
10.1002/hep.27406.
Wang, L., En, H., Yang, L., Zhang, Y., Sun, B., Gao, J., 2019 Aug 21. miR-596 suppresses
the expression of Survivin and enhances the sensitivity of osteosarcoma cells to the
molecular targeting agent anlotinib. OncoTargets Ther. 12, 6825–6838. https://doi.
org/10.2147/OTT.S215145.
Wang, C., Ding, S., Sun, B., Shen, L., Xiao, L., Han, Z., Huang, H., 2020 Nov. Hsa-miR-
4271 downregulates the expression of constitutive androstane receptor and enhances
in vivo the sensitivity of non-small cell lung cancer to gefitinib. Pharmacol. Res. 161,
105110. https://doi.org/10.1016/j.phrs.2020.105110.
Wang, S., Zhang, Y., Ren, T., Wu, Q., Lu, H., Qin, X., Liu, Y., Ding, H., Zhao, Q., 2020 Jun
30. A novel 4-aminoquinazoline derivative, DHW-208, suppresses the growth of
human breast cancer cells by targeting the PI3K/AKT/mTOR pathway. Cell Death
Dis. 11 (6), 491. https://doi.org/10.1038/s41419-020-2690-y.
Wei, L., Lun, Y.Z., Zhou, X.P., Shang, H., Gao, L.J., Liu, Y., He, Z., Li, B.M., Wang, C.B.,
2019. Novel urokinase-plasminogen activator inhibitor SPINK13 inhibits growth and
metastasis of hepatocellular carcinoma in vivo. Pharmacol. Res. 143, 73–85.
http://doi: 10.1016/j.phrs.2019.03.009. Epub 2019 Mar 9.
Xie, H., Tian, S., Yu, H., Yang, X., Liu, J., Wang, H., Feng, F., Guo, Z., 2018. A new
apatinib microcrystal formulation enhances the effect of radiofrequency ablation
treatment on hepatocellular carcinoma. OncoTargets Ther. 11, 3257–3265.
http://doi: 10.2147/OTT.S165000.
Yang, Q., Feng, F., Zhang, F., Wang, C., Lu, Y., Gao, X., Zhu, Y., Yang, Y., 2013. LINE-1
ORF-1p functions as a novel HGF/ETS-1 signaling pathway co-activator and
promotes the growth of MDA-MB-231 cell. Cell. Signal. 25, 2652–2660. https://doi.
org/10.1016/j.cellsig.2013.08.029.
Yang, Y.P., Qu, J.H., Chang, X.J., Lu, Y.Y., Bai, W.L., Dong, Z., Wang, H., An, L.J., Xu,
X., Wang, C.P., Zeng, Z., Hu, K.Q., 2013. High intratumoral metastasis-associated in
colon cancer-1 expression predicts poor outcomes of cryoablation therapy for
advanced hepatocellular carcinoma. J. Transl. Med. 11, 41. http://doi: 10.1186/1
479-5876-11-41.
Yang, B., Wang, C., Xie, H., Wang, Y., Huang, J., Rong, Y., Zhang, H., Kong, H., Yang,
Lu, Y., 2019. MicroRNA-3163 targets ADAM-17 and enhances the sensitivity of
hepatocellular carcinoma cells to molecular targeted agents. Cell Death Dis. 10, 784.
http://doi: 10.1038/s41419-019-2023-1.
Yang, Q., Li, Y., Yang, J.D., Liu, Y.D., Zhang, L., Luo, S.Z., Cheng, J.P., 2020. Holistic
prediction of pKa in diverse solvents based on machine learning approach
intermediates. Angew. Chem. Int. Ed. 59, 19282–19291.
Yang, H., Ren, L., Wang, Y., Bi, X., Li, X., Wen, M., Zhang, Q., Yang, Y., Jia, Y., Li, Y.,
Zang, A., Wei, Y., Dai, G., 2020. FBI-1 enhanced the resistance of triple-negative
breast cancer cells to chemotherapeutic agents via the miR-30c/PXR axis. Cell Death
Dis. 11 (10), 851. https://doi.org/10.1038/s41419-020-03053-0. Oct 13.
Yu, C., Chen, L., Luo, H., Chen, J., Cheng, F., Gui, C., Zhang, R., Shen, J., Chen, K.,
Jiang, H., Shen, X., 2004. Binding analyses between Human PPARgamma-LBD and
ligands. Eur. J. Biochem. 271, 386–397. http://doi: 10.1046/j.1432-1033.2003.03
937.x.
Zhang, P., Ma, X., Song, E., Chen, W., Pang, H., Ni, D., Gao, Y., Fan, Y., Ding, Q.,
Zhang, Y., Zhang, X., 2013. Tubulin cofactor A functions as a novel positive regulator
of ccRCC progression, invasion and metastasis. Int. J. Canc. 133, 2801, 1281. http://
doi: 10.1002/ijc.28306.
Zhang, Y., Li, D., Jiang, Q., Cao, S., Sun, H., Chai, Y., Li, X., Ren, T., Yang, R., Feng, F.,
Li, B.A., Zhao, Q., 2018. Novel ADAM-17 inhibitor ZLDI-8 enhances the in vitro and
in vivo chemotherapeutic effects of Sorafenib on hepatocellular carcinoma cells. Cell
Death Dis. 9, 743. https://doi.org/10.1038/s41419-018-0804-6.
Zhu, M., Li, M., Zhang, F., Feng, F., Chen, W., Yang, Y., Cui, J., Zhang, D., Linghu, E.,
2014 May 23. FBI-1 enhances ETS-1 signaling activity and promotes proliferation of
human colorectal carcinoma cells. PloS One 9 (5), e98041. https://doi.org/10.1371/
journal.pone.0098041.
Zhu, Y.J., Zheng, B., Wang, H.Y., Chen, L., 2017. New knowledge of the mechanisms of
sorafenib resistance in liver cancer. Acta Pharmacol. Sin. 38, 614–622. http://doi:
10.1038/aps.2017.5.
Y. Jie et al.