Index patients were asked for detailed information on family history of breast or any other cancer type in their families. Our study protocol

was approved by the Medical Research Institute, University of Alexandria, Alexandria, Egypt. DNA isolation and PCR amplification for the different exons Blood samples (3 ml each) were collected from the patients (60 women) and the healthy asymptomatic first degree female relatives (120 relatives) in EDTA tubes. Genomic DNA was extracted from peripheral blood lymphocytes using a Promega DNA purification kit (Promega, Madison, USA), following the manufacturer’s AZD2171 nmr instructions. Universal primers (Table 1) were used to amplify four regions of the BRCA1 gene (exons 2, 8, 13 and 22)

and one region of BRCA2 gene (exon 9). The polymerase chain reaction (PCR) was carried out using 50 ng of DNA, 10 × PCR buffer with 1.5 mM MgCl2, 2 ul of mixture of 4 mM dNTPs, 20 pmol of each primer and 1U of Tag DNA polymerase at final volume of 25 ul. The PCR conditions were 96°C for 5 minutes, then 35 cycles each consists of 30 sec at 94°C, one min at the annealing temperature of the primer used (mostly around 56-59°C) and one min at 72°C, followed by one cycle at 72°C for 10 minutes. Table 1 Primers’ sequences employed in the specific-PCR Primers Sequence (5′- 3′) BRCA1 Exon 2 Sense: GAAGTTGTCATTTTATAAACCTTT Antisense: GTCTTTTCTTCCCTAGTATGT BRCA1 Exon 8 Sense: TGTTAGCTGACTGATGATGGT Antisense: ATCCAGCAATTATTATTAAATAC BRCA1 Exon 13 Sense:

DOCK10 AATGGAAAGCTTCTCAAAGTA Antisense: ATGTTGGAGCTAGGTCCTTAC BRCA1 Exon 22 Sense: ATG TTG GAG CTA GGT Elafibranor chemical structure CCT TAC Antisense: GAG AAG ACT TCT GAG GCT ACG BRCA2 Exon 9 Sense: CAT CAC ACT ACT CAG GAT GAC A Antisense: GCA TGG TGG TGC ATG CTT GTA Mutation detection using the Single Ivacaftor strand conformation polymorphism assay (SSCP) SSCP analysis were used to screen for mutations in the exons 2, 8, 13, 22 of BRCA1 gene and exon 9 of BRCA2 gene in all studied subjects[18, 19]. Every PCR product was mixed 1:1 with loading buffer (95% formamide, 0.05% bromophenol blue and 0.05% xylene cyanol), and denature at 98°C for 10 min and suddenly place in ice. Electrophoresis of the denatured PCR products were carried out in 8% polyacrylamide gel containing 5% glycerol and the run was performed at 30 mA constant current for 6 hours. After that, the gel was stained by Ethidium Bromide for minutes, washed by water and visualized using the gel documentation system. Mutation detection using heteroduplex analysis Heteroduplex assay was carried out, as a confirmatory analysis for detecting mutations, in case of families which had no detected mutation in either of the studied exons of both genes by SSCP assay. PCR for the patients and normal samples were carried out using the specific primer of any one of the studied exons.