Louis, MO, USA) and used without further purification steps. Rabbit anti-H1 polyclonal Ab was obtained from AbFrontier (Seoul, Korea).2.2. Design and Fabrication of Microfluidic DeviceThe microfluidic immunosensor device is fabricated by the injection molding method. The master stamp was fabricated using a micromilling process. The size and thickness of the stamp were 95 �� selleck chemicals Ponatinib 95 mm and 1.2 mm, respectively. We used a plastic microinjection mold machine (A270C 400-100, ARBURG, Lossburg, Germany) to produce the microfluidic device in order to achieve cost-effectiveness and facilitate mass production. Once the chip was fabricated, chromium (50 ?) and gold (100 ?) were coated on the detection area for further immobilization of GBP-H1a.
In this work, the ultrasonic bonding method with an ultrasonic bonder (2000X, Branson, Danbury, CT, USA) was employed to bond the COC chips. For this purpose a melting line with a height of 20 ��m was made around microchannels. Once the ultrasonic energy was applied to the COC plates, the sonic energy was intensively localized on the top of Inhibitors,Modulators,Libraries the Inhibitors,Modulators,Libraries melting line. After the lines were immediately melted and then cooled, both COC plates were tightly bonded with each other to fabricate the plastic-based microfluidic device.2.3. Preparation of GBP-H1a Fusion ProteinBifunctional fusion protein was created by genetically fusing GBP and H1a, allowing specific interactions between GBP and the gold substrates as well as the capture of H1a and its antibodies.
As described in the previous report [16], the DNA fragments encoding Inhibitors,Modulators,Libraries the H1N1 viral surface antigen (H1a) were amplified by PCR with forward primer (5��-CCATGGCATATGGG CCACCATCACCATCACCACGGCAA-3��) and reverse primer (5��-CCGCTCGAGCTGGCTACG Inhibitors,Modulators,Libraries CACTTTTTCATACAGGTTTTTAACGTTGCTATCGTGATAGCCGCAAGCTTGTCGACA-3��) for the construction of 6His-GBP-H1a fusion gene. Then, the PCR product was cloned into the NdeI-XhoI fragment of pET-6HGBP to make pET-6HGBP-H1a.Recombinant E. coli BL21 (DE3) strain harboring pET-6HGBP-H1a was cultivated in Luria-Bertani (LB) medium (10 g/L bacto-tryptone, 5 g/L yeast extract, and 5 g/L NaCl) supplemented with 100 ��g/mL of ampicillin at 37 ��C and 250 rpm. At OD600 (DU600? Spectrophotometer, Beckman Coulter, Brea, CA, USA) of 0.4, cells were induced with 1 mM of isopropyl-��-D-thiogalactopyranoside (IPTG, Sigma) for Anacetrapib the production of the fusion protein.
After induction, cells were further cultured for 4 h. The cells were then harvested and disrupted by sonication (Braun http://www.selleckchem.com/products/epz-5676.html Ultrasonics, Orlando, FL, USA) for 1 min at 20% output power. After centrifugation at 16,000�� g for 10 min at 4 ��C, the pellet containing the soluble protein fraction with high-level expressed target fusion-protein was collected for purification of the fusion protein. Because of the 6His tags, a HisTrap? column (GE Healthcare, Chalfont St. Giles, UK) was used to purify the fusion protein without further purification steps.