The primers used were: α3 subunit (401 bp), sense primer CCATGTCTCAGCTGGTG, X-396 research buy antisense primer GTCCTTGAGGTTCATGGA; α4 subunit (346 bp), sense primer TGGGTGAAGCAGGAGTGG, antisense primer AGTCCAGCTGGTCCACG; α7 subunit (414 bp), sense primer CCTGGCCAGTGTGGAG, antisense primer TACGCAAAGTCTTTGGACAC; α9 subunit (403 bp), sense primer GTCCAGGGTCTTGTTTGT, antisense primer ATCCGCTCTTGCTATGAT; glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 447 bp), sense primer ACCACAGTCCATGCCATCAC, antisense primer TCCACCACCCTGTTGCTGTA. The PCR amplification was carried out for 35 cycles (1 min at 95°, 30 seconds at 95° and 1 min at 68° repeated

for 34 cycles, and 1 min at 68°). Aliquots of the PCR products were run on 2% agarose gels and visualized by ethidium bromide staining. The effects of pertussis toxin, U-73122, U0126 and SP600125 on various mast cell functions induced by catestatin and its variants were evaluated by pre-treating mast cells with pertussis toxin (1000 ng/ml), U-73122 or its inactive control U-73343 (10 μm each), U0126 (10 μm), or SP600125 (20 μm) for 2 hr at 37° in StemPro-34 medium. The cells were then stimulated with wild-type catestatin and its variants for indicated time periods,

and appropriate assays were performed as described above. Mast cells (1 × 106 cells) were stimulated with 5 μm catestatins for 5 min to 1 hr. After stimulation, cell lysates were obtained by lysing cells in lysis buffer (50 mm Tris–HCl (pH 8), 150 mm NaCl, 0·02% NaN3, 0·1% SDS, 1% Nonidet P-40 containing a protease Selleck Nivolumab inhibitor cocktail, Phosphatase Inhibitor Cocktail 1 and Cocktail 2

(Sigma-Aldrich) prepared according to the manufacturer’s instructions. The amount of total protein was determined using a BCA Protein Assay (Pierce Chemical, Rockford, IL), and equal amounts of total protein were subjected to 12·5% SDS–PAGE analysis. After the non-specific binding sites were blocked, the blots were incubated with polyclonal antibodies against phosphorylated Cediranib (AZD2171) or unphosphorylated p38, ERK and JNK overnight. The membranes were developed using an enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech, Piscataway, NJ). Intracellular Ca2+ mobilization was measured by a no-washing method using a FLIPR Calcium Assay kit (Molecular Devices, Sunnyvale, CA). Cells (100 μl) were seeded at a density of 2 × 105 cells per well into 96-well, black-walled, clear-bottom microtitre plates coated with poly-d-lysine (Becton-Dickinson, NJ), and then loaded for 1 hr at 37° in an equivalent volume of Hanks’ balanced salt solution containing 20 mm HEPES, 2·5 mm probenecid (Sigma-Aldrich), and Calcium 3 Reagent (Molecular Devices, Menlo Park, CA), pH 7·4, prepared according to the manufacturer’s instructions. To form a uniform monolayer of cells on the bottoms of the wells, the microplate was gently centrifuged for 5 min with low acceleration and without brake.