These isolates were selected systematically (isolates received closest to the 1st and 15th of each month from 2005 – 2011 were selected)

to represent an unbiased collection of human clinical isolates. PFGE-XbaI analysis of these isolates was conducted using standard protocols [7, 53]. All isolates were stored at -80°C in 20% glycerol. Isolates were grown overnight in 2 mL LB at 37°C in a shaking incubator. DNA was isolated using the Promega genomic Ilomastat DNA isolation kit, following the manufacturer’s directions (Promega, Madison, WI). DNA samples were stored at -20°C prior to PCR analysis. PCR amplification Primers for amplification of all four genomic loci are listed in Table 6. PCR reactions were performed in a total volume of 25 μl: 1.5 μl template, 0.3 μl Taq (1.5 units; New England Bio Labs, Ipswich, MA), 0.2 μl 10 mM dNTPs, selleck chemicals 1 μl of each 10 μM primer, 2.5 μl of 10× Taq buffer and 18.5 μl water. PCR conditions were as follows and the annealing temperatures (AT) are listed in Table 6: initial denaturation step of 10 minutes at 94°C followed by 35 cycles of 1 minute at 94°C, 1 minute at AT and extension for 1 minute (fimH and sseL) or 1.5 minutes

(CRISPR1 and CRISPR2) at 72°C; a final extension step was done at 72°C for 8 minutes. 5 μl of each PCR product was electrophoretically analyzed on a 1.2% agarose gel and the remaining reaction stored at -20°C. Table 6 List of primers used in this study for PCR amplification and sequencing of the four CRISPR-MVLST markers Primer Orientation Primer sequence (5′-3′) Annealing selleckchem temp. PCR Sequencing CRISPR1-5 Forward TGAAAACAGACGTATTCCGGTAGATT 55.5 ✓ ✓ CRISPR1-1 Reverse CAGCATATTGACAAGGCGCT ✓ ✓ CRISPR2-3 Forward ATTGTTGCGATTATGTTGGT 57 ✓ ✓ CRISPR2-1 Reverse TCCAGCTCCCTTATGATTTT ✓   CRISPR2-4 Reverse GCAATACCCTGATCCTTAACGCCA

    ✓ CRISPR2-5 Reverse CGACGAAATTAAAACCGAACT     ✓ CRISPR2-6 Forward CGGATTCCATGCGTTTTCA     ✓ CRISPR2-7 Forward CCGGCGAGGTCAATAAAA     ✓ CRISPR2-8 Forward TGACGCTGGTCTATACCG     ✓ CRISPR2-9 Forward GTGACGTCAGTGCCGAA     ✓ CRISPR2-10 Reverse CTCTTCGCACTCTCGATCAA     ✓ fimH-1 Forward AGGTGAACTGTTCATCCAGTGG 56.7 ✓ ✓ fimH-2 Reverse GCGGGCTGAACAAAACACAA ✓ ✓ sseL-1 Forward AAAATCAGGTCTATGCCTGATTTAATATATC 60 ✓   sseL-2 Reverse GGCTCTAAGTACTCACCATTACT ✓   sseL-3 Forward ACCAGGAAACAGAGCAAAATGAATATATGT     ✓ sseL-4 Forward TTCTCTCGGTAAACTATCCTATTGGGC     ✓ DNA sequencing PCR products were treated with 10 units of Exonuclease (New England Bio Labs, Ipswich, MA) and 1 unit of Antarctic alkaline phosphatase (New England Bio Labs, Ipswich, MA). The {Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|buy Anti-infection Compound Library|Anti-infection Compound Library ic50|Anti-infection Compound Library price|Anti-infection Compound Library cost|Anti-infection Compound Library solubility dmso|Anti-infection Compound Library purchase|Anti-infection Compound Library manufacturer|Anti-infection Compound Library research buy|Anti-infection Compound Library order|Anti-infection Compound Library mouse|Anti-infection Compound Library chemical structure|Anti-infection Compound Library mw|Anti-infection Compound Library molecular weight|Anti-infection Compound Library datasheet|Anti-infection Compound Library supplier|Anti-infection Compound Library in vitro|Anti-infection Compound Library cell line|Anti-infection Compound Library concentration|Anti-infection Compound Library nmr|Anti-infection Compound Library in vivo|Anti-infection Compound Library clinical trial|Anti-infection Compound Library cell assay|Anti-infection Compound Library screening|Anti-infection Compound Library high throughput|buy Antiinfection Compound Library|Antiinfection Compound Library ic50|Antiinfection Compound Library price|Antiinfection Compound Library cost|Antiinfection Compound Library solubility dmso|Antiinfection Compound Library purchase|Antiinfection Compound Library manufacturer|Antiinfection Compound Library research buy|Antiinfection Compound Library order|Antiinfection Compound Library chemical structure|Antiinfection Compound Library datasheet|Antiinfection Compound Library supplier|Antiinfection Compound Library in vitro|Antiinfection Compound Library cell line|Antiinfection Compound Library concentration|Antiinfection Compound Library clinical trial|Antiinfection Compound Library cell assay|Antiinfection Compound Library screening|Antiinfection Compound Library high throughput|Anti-infection Compound high throughput screening| mixture was incubated for 40 minutes at 37°C to remove remaining primers and unincorporated dNTPs. The enzymes were inactivated by incubating the samples at 85°C for 15 minutes. Purified PCR products were sequenced at the Huck Institute’s Nucleic Acid Facility at The Pennsylvania State University using 3’ BigDye-labeled dideoxynucleotide triphosphates (v 3.