We report that the transduction of primary rat monocytes is best achieved by using lentiviral vectors or the protein delivery system Bioporter. We also demonstrate that Bioporter does not alter monocyte function as measured by their ability selleck to phagocytose Aβ and begin differentiation. All non-viral transfection experiments were carried out using the expression vectors pEF-NGF or pcDNA3.1-NGF. Expression vector pEF-neo (5636 bp) was generated as previously described (Wiesenhofer and Humpel, 2000 and Zassler and Humpel, 2006) and contains the functional

gene NGF (rat, [GenBank: M36589], 723 bp) subcloned into a unique EcoRI restriction site in the pEF-neo vector. pEF-(−) was used in control experiments and consists of the pEF-neo vector containing a 380 bp Stuffer inserted into a unique BstXI restriction site. In order to generate pcDNA3.1-NGF, JAK inhibitor the coding sequence of rat NGF was amplified from plasmid pEF-NGF using primers CACCATGTCCATGTTGTTCTAC and TCAGCCTCTTCTTGCAGC. The PCR fragment was gel-purified and cloned into mammalian expression vector pcDNA3.1D/V5-His-TOPO (Invitrogen) at BamHI and XbaI sites. The fidelity and orientation of pcDNA3.1D/V5-His-ratNGF was then confirmed by restriction digest and sequencing. The plasmid pcDNA3.1-ratNGF

under the control of the CMV promoter was generated to determine if transfection efficiency could be optimized with a different expression vector and promoter. Two lentiviral vectors (pHR-bA-NGF and pHR-SFFV) were also generated under the β-actin and SFFV promoters (see below for details). Primary rat monocytes were freshly isolated as previously described by us with some modifications (Humpel, 2008, Böttger et al., 2010 and Hohsfield and Humpel, 2010). In brief, Sprague–Dawley rats (250 g, Himberg, Austria) were anesthetized by an intraperitoneal injection of 40 mg/kg body weight thiopental (Sandoz, Kundl, Austria) and perfused with 500 ml of 4 °C pre-chilled 10 mM phosphate-buffer saline (PBS)/2.7 mM EDTA/25 mg/ml heparin, pH 7.3 through the left ventricle. The collected effluent was centrifuged at 550 ×g for 10 min at 4 °C.

The perfusate pellet was resuspended in 50 ml not of 10 mM PBS/1% bovine serum albumin (BSA; SERVA Electroporesis, Heidelberg, Germany)/2.7 mM EDTA, pH 7.3 and carefully overlaid on a Percoll working solution ( Scriba et al., 1996). After centrifugation at 500 ×g for 30 min at 4 °C, peripheral blood mononuclear cells (PBMC) were harvested from the interface. PBMC were then washed once with 50 ml of PBS and ~ 20 × 106 PBMC were resuspended in 100 μl of PBS/BSA/EDTA. Monocytes were purified from PBMC by negative magnetic selection: PBMC were incubated in a cocktail consisting of four different purified anti-rat monoclonal antibodies (20 μg of each: CD8a (clone OX-8), CD5 (clone OX-19), CD45RA (clone OX-33), PAN T (clone OX-52); all from Cedarlane Laboratories, Szabo, Austria) for 10 min at 4 °C shaking.